The weather is still beautiful in New York City. We didn't think we would still be spending time outside, but here we are. (And no, this is not part of the script.)
Today we talked about DNA replication--when a molecule of DNA makes a replica of itself. One of the most important features of DNA is that it can be copied with incredible accuracy. But how can a cell possibly do that? Make an exact copy a DNA sequence such as, say, ATTGCGAAATCGGCTAATAA times a trillion, without making mistakes?
Well, in the 1950's, scientists were going crazy trying to answer this very question. They discussed it endlessly, they did hundreds of experiments, and they made many, many models. They came up with these three possibilities:
In 1958, in a very cool experiment, Matthew Meselson and Franklin Stahl determined that the "semi-conservative" model, also called the "zipper model," was the correct one.
This model proposed that during replication, the DNA molecule is unwound and that the two strands of the double helix, now separated, each act as a template for its missing half. Thus, two new molecules, identical to the original molecule, emerge.
Home-made DNA molecule, unwound and ready to replicate:
And that's why all the cells in our body have the same DNA. It starts very early in the process. That first cell replicates its DNA, then divides in two; then the daughter cells replicate their DNA, and divide in two, and you can guess how this process goes on and on.
The truth is that mistakes are made when DNA is copied, lots of them, but they are minute "mechanics" that repair our DNA all the time. When an error is made in a copy of DNA and it's not repaired, that's called a mutation.
The evolving script
Today we also incorporated the first scientific explanations in the script. Who's going to explain what?
We had to make some decisions. How much does a simple diva know about DNA? Not much. How much does an FBI agent know? Well, this one knows quite a lot. We can't comment on the real ones becasue they are a very secretive lot.
The scientist turned out to be a bit cuckoo, but in a good way. (No, it will not be a stereotypical scientist, not in this class)
And the burglar? She is smarter than all of them together. Or is she?
Girls hard at work
Next Wednesday we are having a double feature. A visit to the American Musem of Natural History + a class and picnic in Central Park. Till then!